CpG adjuvants are a class of immunostimulatory agents widely used in vaccine development and immunotherapy. They work primarily by stimulating Toll-like receptor 9 (TLR9), triggering involuntary immune responses, and increasing vaccine immunogenicity. CpG oligodeoxynucleotides (ODNs), synthetic DNA fragments encoding unmethylated CpG motifs, are the most widely researched CpG adjuvants. Through their activation of TLR9, CpG ODNs trigger DC activation and development, allowing DCs to travel to the lymph nodes and trigger both humoral and cellular immune activity.
Figure 1. Mechanisms by which CpG oligodeoxynucleotides promote innate and adaptive immune responses[1].
Amid these, CpG adjuvants fall into the K-type, C-type, P-type, and D-type types in terms of structural properties and immunological activity. K-type CpG works most effectively against DCs and B cells, while C-type is more toxic and has less use in the clinic. The p- and D-type CpG play very unique functions (activating plasmacytoid DCs) and thus would be useful in the context of immunotherapies with this niche.
Table 1. Comparison of D, K, C and P-type oligodeoxynucleotide[1]
| ODN type | Representative sequence | Structural characteristics | Immune effects |
| D- also referred to as A-class | GGTGCATCGATGCAGGGGGG | Mixed phosphodiester/phosphorothioate backbone Single CpG motif CpG flanking region forms a palindrome Poly G tail at 3′ end | Induces strong pDC IFN-α secretion APC maturation |
| K- also referred to as B-class | TCCATGGACGTTCCTGAGCGTT | Phosphorothioate backbone Multiple CpG motifs 5′ motif most stimulatory | Induces strong B-cell activation pDC maturation Preferentially supports the production of TNF-α and IL-6 |
| C | TCGTCGTTCGAACGACGTTGAT | Phosphorothioate backbone Multiple CpG motifs TCG dimer at 5′ end CpG motif imbedded in a central palindrome | Induces B-cell and pDC proliferation and differentiation Induces production of IL-6 and IFN-α |
| P | TCGTCGACGATCGGCGCGCGCCG | Phosphorothioate backbone Two palindromes Multiple CpG motifs | Stimulates pDC and B cells Strong IFN-α secretion |
CpG ODNs are made even more immunostimulatory by combining them with other adjuvants (like aluminum salts). CpG-aluminum adjuvants, for example, are especially good at generating Th1-type immune responses that are essential to fighting intracellular infections and cancer.
The utility of CpG adjuvants has made them usable in vaccines ranging from infectious disease vaccines to cancer immunotherapies and allergy drugs. In flu vaccines, CpG ODNs boost IgG antibody and cytotoxic T lymphocyte (CTL) production and therefore protective immunity. For cancer, CpG ODNs can be effective in triggering tumor-specific immune responses by calling upon the host immune system to attack malignant cells. And they have potential in modifying hypersensitive immune responses when integrated into allergen-based immunotherapy.
| Application Area | Benefits of CpG Adjuvants |
| Infectious Diseases | Enhanced antibody production and accelerated immune responses |
| Cancer Immunotherapy | Activation of tumor-specific immune responses |
| Allergy Vaccines | Modulation of hypersensitivity and improved tolerance |
Significant advances have been made in the clinical use of CpG adjuvants. The first CpG vaccine, Dynavax's Heplisav-B hepatitis B vaccine with ISS-1018 CpG adjuvant, was approved in 2017 in the United States. The vaccine proved more immunogenic at 3,000 g/shot. Other CpG-based agents—those that are effective against anthrax and influenza—are going through large-scale clinical trials. CpG adjuvants have temporary side effects (injection site inflammation, flu-like symptoms) even if they're effective. Dose optimisation and combinatorial approaches are being tried to counter these problems.
CpG adjuvants are a quantum leap in immunotherapy and vaccine research because they enable better immune responses and application flexibility. Even with CpG adjuvants, it is still far from an answer, both in terms of safety and the accessibility of customised delivery vehicles. Their symbiotic effects with other adjuvants and tailoring them to specific disease states are currently under research. Alfa Chemistry and other innovators still invent CpG adjuvant synthesis and use, which has enabled them to evolve into the core components of modern immunotherapy and vaccines.
Reference
Our products and services are for research use only and cannot be used for any clinical purposes.
As a specialist in oligonucleotide therapeutics, Alfa Chemistry offers consumers a wealth of raw materials and a full range of technologies and services.
Privacy Policy | Cookie Policy | Copyright © 2025 Alfa Chemistry. All rights reserved.
